View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_42 (Length: 221)
Name: NF3472_low_42
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 34274954 - 34274767
Alignment:
| Q |
14 |
cagagatggtatcagcaaacgaacttgaatactcagttgcatcagggtcctcaatttcgttagatgcatcaggaacgacttctgcacttgtaatgtcgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274954 |
cagagatggtatcagcaaacgaacttgaatactcagttgcatcagggtcctcaatttcgttagatgcatcaggaacgacttctgcacttgtaatgtcgat |
34274855 |
T |
 |
| Q |
114 |
ttgttcctcaggaacggactccaccttaatgacatgcttagccatcttcacctttttagtttcctgttctgaaccaaaatgcacaagt |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274854 |
ttgttcctcaggaacggactccaacttaatgacatgcttagccatcttcacctttttagtttcctgttctgaaccaaaatgcacaagt |
34274767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 34281750 - 34281707
Alignment:
| Q |
22 |
gtatcagcaaacgaacttgaatactcagttgcatcagggtcctc |
65 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
34281750 |
gtatcagcaaaggaactcgaatattcagttgcatcagggtcctc |
34281707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 149 - 182
Target Start/End: Original strand, 20229778 - 20229811
Alignment:
| Q |
149 |
gcttagccatcttcacctttttagtttcctgttc |
182 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
20229778 |
gcttagccatcttcacctttttagttacctgttc |
20229811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University