View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_43 (Length: 212)
Name: NF3472_low_43
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_43 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 9938238 - 9938026
Alignment:
| Q |
1 |
aaaactctctttcaattggcttattctttctgaatattcgtaggaagc--tatcatccgatcaattttgaacaacctggagagcaaccttcatacactgt |
98 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938238 |
aaaactctctttcaattggcttattttttctgaatattcctaggaagcgctatcatccgatcaattttgaacaacctggagagcaaccttcatacactgt |
9938139 |
T |
 |
| Q |
99 |
ttaatatatacacattaaatccattattttagtgatttataaataattgcttatctgttaaattcttataaacatatccttacttaggtgaagaacaaat |
198 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938138 |
tta-tatatacacattaaatccattattttagtgatttataaataattgcttatctgttaaattcttataaacatatccttacttaggtgaagaacaaat |
9938040 |
T |
 |
| Q |
199 |
ttgttataaaagag |
212 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9938039 |
ttgttataaaagag |
9938026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University