View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3472_low_8 (Length: 446)
Name: NF3472_low_8
Description: NF3472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3472_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 239 - 430
Target Start/End: Original strand, 9945978 - 9946169
Alignment:
| Q |
239 |
tacagtcattgtcattgtcatcattgcatttggcggcattgccttgctctccatgcttgcttttgcattattttgctgcgttcaaaagaggaagaagaaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945978 |
tacagtcattgtcattgtcatcattgcatttggtggcattgccttgctctccatgcttgcttttgcattattttgctgcgttcaaaagaggaagaagaaa |
9946077 |
T |
|
| Q |
339 |
caagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaaccactggtggtggttac |
430 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||||| |||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
9946078 |
caagaaaccgatgtcattcatatcgatgaacataaaaagattacggaaaacattgtgcctggtccttttggacaaccaacggtggtggttac |
9946169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 4 - 62
Target Start/End: Original strand, 9945737 - 9945795
Alignment:
| Q |
4 |
cttttaaccctccaccacctcattccatcaaatctccaccaccagcaccatctcattca |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945737 |
cttttaaccctccaccacctcattccatcaaatctccaccaccagcaccatctcattca |
9945795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 414
Target Start/End: Complemental strand, 1022214 - 1022129
Alignment:
| Q |
329 |
gaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaac |
414 |
Q |
| |
|
|||||||| |||||||||||||||| | || ||| |||| ||||||||| || ||||| ||||| ||||||||| |||||||| |
|
|
| T |
1022214 |
gaagaagacacaagaaaccgatatcatacacatcgatgagcataaaaagggcaaggaaaccattgtacctggtccttttggacaac |
1022129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University