View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3474_low_2 (Length: 501)
Name: NF3474_low_2
Description: NF3474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3474_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 138 - 418
Target Start/End: Complemental strand, 30965534 - 30965254
Alignment:
| Q |
138 |
attgcctctctaatttttctttcatcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattat |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965534 |
attgtctctctaatttttctttcatcccttttctccttcatcctcaagcgctgctcacggccctctccaaagtaaaattgatacattctatgaacattat |
30965435 |
T |
|
| Q |
238 |
aaaatgtttgaattatctccacaatgatatggataataatgatgacaaaaaccacataagaaccatatttaatcttttctattagatagaccactgaatc |
337 |
Q |
| |
|
||||||||||||||||| |||||||| | | ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30965434 |
aaaatgtttgaattatccccacaatggttttgataataatgatgacaaaaactacataaaaaccatatttaatcttttctattagatagagcactgaatc |
30965335 |
T |
|
| Q |
338 |
atgaccagtagtaagtccaaggttcttgtcatcctcgcattttggtggtggtggtgaaccatcacaccctcctccacaatc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965334 |
atgaccagtagtaagtccaaggttcttgtcatcctcgcattttggtggtggtggtgaaccatcacaccctcctccacaatc |
30965254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 439 - 485
Target Start/End: Complemental strand, 30965248 - 30965202
Alignment:
| Q |
439 |
cgcaaccagtttggccgcacaaggaagcaacatcaacaagtagaagc |
485 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965248 |
cgcaaccggtttggccgcacaaggaagcaacatcaacaagtagaagc |
30965202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University