View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3474_low_4 (Length: 362)
Name: NF3474_low_4
Description: NF3474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3474_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 47310100 - 47310318
Alignment:
| Q |
16 |
attatttccaacgtgtgataggtttccttaggtggaggcctccgcaagataattgggtgaatttaaatacggatggtgcttgtaggggagggaatatagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47310100 |
attatttccaacgtgtgataggtttccttaggtggaggcctccgcaagataattgggtgaatttaaatacggatggtgcttgtaggggagggaatatagt |
47310199 |
T |
 |
| Q |
116 |
ttagttgttgtggtattattagaggcagtgatggacaatggattggtggttttgtcaaattcatcgaagattgtggtgtgtttgtggctgaattgtgaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47310200 |
ttagttgttgtggtattattagaggcggtgatggacaatggattggtggttctgtcaaattcatcgaagattgtggtgtgtttgtggctgaattgtgaaa |
47310299 |
T |
 |
| Q |
216 |
agttttttacggtttgagc |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47310300 |
agttttttacggtttgagc |
47310318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 231 - 339
Target Start/End: Original strand, 47310376 - 47310484
Alignment:
| Q |
231 |
gagcaaatcatgaagtcaagtaagttagatagtcgcttgggttgagcgtcggtaaatcaaattcgtcacttgttggagatggattgaaatgttgaagttt |
330 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47310376 |
gagcagatcatgaagtcaagtaagttacatagtcgcttgggtcgagcgtcggtaaatcaaattcgtcacttgttggagattgattgaaatgttgaagttt |
47310475 |
T |
 |
| Q |
331 |
ttcactcat |
339 |
Q |
| |
|
||||||||| |
|
|
| T |
47310476 |
ttcactcat |
47310484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 23 - 168
Target Start/End: Original strand, 50564617 - 50564758
Alignment:
| Q |
23 |
ccaacgtgtgataggtttccttaggtggaggcctccgcaagataattgggtgaatttaaatacggatggtgcttgtaggggagggaatatagtttagttg |
122 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||| ||||| | |||||||||||| ||||||| ||||||||| || | ||| || ||||||| | ||||| |
|
|
| T |
50564617 |
ccaatgtgtgatagatttcattaggtggaggtctccg---gttaattgggtgaagttaaatagggatggtgcgtgcaagggtggaaatatagct-agttg |
50564712 |
T |
 |
| Q |
123 |
ttgtggtattattagaggcagtgatggacaatggattggtggtttt |
168 |
Q |
| |
|
| |||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
50564713 |
tggtggtattattagagggagtgatggagaatggattggtggtttt |
50564758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 257 - 316
Target Start/End: Complemental strand, 31338417 - 31338358
Alignment:
| Q |
257 |
agatagtcgcttgggttgagcgtcggtaaatcaaattcgtcacttgttggagatggattg |
316 |
Q |
| |
|
|||||||||||||||| |||||| || ||| ||||||||| ||| |||||||||||||| |
|
|
| T |
31338417 |
agatagtcgcttgggtagagcgttagttaataaaattcgtcgcttattggagatggattg |
31338358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 128 - 179
Target Start/End: Complemental strand, 31338691 - 31338640
Alignment:
| Q |
128 |
gtattattagaggcagtgatggacaatggattggtggttttgtcaaattcat |
179 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31338691 |
gtattattagagggaatgatggagaatggattggtggttttgctaaattcat |
31338640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University