View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3475_high_13 (Length: 250)

Name: NF3475_high_13
Description: NF3475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3475_high_13
NF3475_high_13
[»] chr4 (2 HSPs)
chr4 (125-208)||(10126641-10126724)
chr4 (114-174)||(10126724-10126784)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 208
Target Start/End: Complemental strand, 10126724 - 10126641
Alignment:
125 attactcatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagt 208  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10126724 attacacatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagt 10126641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 114 - 174
Target Start/End: Complemental strand, 10126784 - 10126724
Alignment:
114 ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatccttctaaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
10126784 ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatcattctaaa 10126724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University