View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3475_low_15 (Length: 273)
Name: NF3475_low_15
Description: NF3475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3475_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 43638462 - 43638728
Alignment:
| Q |
1 |
gccccggttaacatttaccttaacttaattaactcttattgaaagttatttgcacctttttgaattctacgttggaactattataaggatgaactannnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638462 |
gccccggttaacatttaccttaacttaattaactcttattgaaagttatttgcacctttttgaattctacgttggaactattataaggatgaactatttt |
43638561 |
T |
 |
| Q |
101 |
nnnnggtaacattttataaggatgaactatgagtgaaaatacttgggaggaaaatattaaaattgatcaaactattagcttgtgagacttgtgtgtgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638562 |
tttttgtaacattttataaggatgaactatgagtgaaaatacttgggaggaaaatattaaaattgatcaaactattagcttgtgagacttgtgtgtgttg |
43638661 |
T |
 |
| Q |
201 |
tatctcactttacacaacacttatgaacccttccnnnnnnnnttctcaattcctgtattcttctctc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
43638662 |
tatctcactttacacaacacttatgaacccttccaaaaataattctcaattcctgtattcttttctc |
43638728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University