View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3475_low_17 (Length: 250)
Name: NF3475_low_17
Description: NF3475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3475_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 208
Target Start/End: Complemental strand, 10126724 - 10126641
Alignment:
| Q |
125 |
attactcatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagt |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10126724 |
attacacatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagt |
10126641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 114 - 174
Target Start/End: Complemental strand, 10126784 - 10126724
Alignment:
| Q |
114 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatccttctaaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10126784 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatcattctaaa |
10126724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University