View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3475_low_19 (Length: 241)
Name: NF3475_low_19
Description: NF3475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3475_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 42290755 - 42290549
Alignment:
| Q |
15 |
tatatggtaaatgaaagtttgagaggcagcacatgatatgatttatttaatagaaaatttataacaatgaatacgattgaacagttttttgtcgtgaagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42290755 |
tatatggtaaatgaaagtttgagaggcagcacatgatatgattta----atagaaaatttataacaatgaatacgattgaacagttttttgtcgtgaagc |
42290660 |
T |
 |
| Q |
115 |
atttaatgattttaaagcagaaaagaaatgtacctgttgtggcgatgagtcatcatgatcgtgaggaacaaaaatggttttacgaggcggtggtcgattg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42290659 |
atttaatgattttaaagcagaaaagaaatgtacctgttgtggcgatgagtcatcatgatcgtgaggaacaaaaatggttttacgaggcggtggtcgattg |
42290560 |
T |
 |
| Q |
215 |
tagcaataaac |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
42290559 |
tagcaataaac |
42290549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University