View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3475_low_20 (Length: 227)
Name: NF3475_low_20
Description: NF3475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3475_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 125
Target Start/End: Original strand, 53538847 - 53538952
Alignment:
| Q |
19 |
gattacaaaatttaataaactaaggatataatatcnnnnnnnttgaggtgtgagagtagcattaagatagcagcagaaactttaagttactaattctttg |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53538847 |
gattacaaaatttaacaaactaaggatataatatcaaaaaa-ttgaggtgtgagaatagcattaagatagcagcagaaactttaagttactaattctttg |
53538945 |
T |
|
| Q |
119 |
ttaacaa |
125 |
Q |
| |
|
||||||| |
|
|
| T |
53538946 |
ttaacaa |
53538952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 38508795 - 38508845
Alignment:
| Q |
119 |
ttaacaaagaatgcaccttacctttgcatttcaacagtaaattaaacttcc |
169 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
38508795 |
ttaacaaagaatgcagattacctctgcatttcaacagtaaattaaacttcc |
38508845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 169
Target Start/End: Original strand, 7120341 - 7120391
Alignment:
| Q |
119 |
ttaacaaagaatgcaccttacctttgcatttcaacagtaaattaaacttcc |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
7120341 |
ttaacaaagaatgcacattacctttgcaattcaactgtaaattaaacttcc |
7120391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University