View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3477_low_5 (Length: 204)
Name: NF3477_low_5
Description: NF3477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3477_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 6 - 195
Target Start/End: Complemental strand, 36640853 - 36640666
Alignment:
| Q |
6 |
tggaggagcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgt |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36640853 |
tggaggggcagagaatttggcggcctgaggattgaagtgtgtg--gcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgt |
36640756 |
T |
|
| Q |
106 |
atatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttgatgatgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36640755 |
atatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttgctgatgt |
36640666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 6 - 188
Target Start/End: Complemental strand, 36633487 - 36633305
Alignment:
| Q |
6 |
tggaggagcagagaatttggcggcctgaggattgaagtgtgtgaggcttgctagtttgcaattcaaaatttattttgcagaaatagagaaatctatttgt |
105 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36633487 |
tggaggggcagagaatttggtggcctatggattaaagtgtgtgaggcttgctagtttgcaattcaaaatttattttacagaaatagagaaatctatttgt |
36633388 |
T |
|
| Q |
106 |
atatctgtcagtttgctgctgtcctgactgattcggatgctgttgtggtggggcgtgtttagctgataggtgggattgtgttg |
188 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36633387 |
atatctgtctgtttgctgctgtcctgactgattcggatgctgttgtggtggggtgtgtttagctgataggtgggattgtgttg |
36633305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University