View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3478_high_15 (Length: 294)

Name: NF3478_high_15
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3478_high_15
NF3478_high_15
[»] chr4 (1 HSPs)
chr4 (188-286)||(40606669-40606767)
[»] chr1 (1 HSPs)
chr1 (18-62)||(10623510-10623554)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 188 - 286
Target Start/End: Original strand, 40606669 - 40606767
Alignment:
188 catagtaaccattgttatgtttcgttaagtgcacttgttgcagtagaaggcactgtgtaatgtggctgatatttttatgtttccttagatcaatccttt 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||||    
40606669 catagtaaccattgttatgtttcgttaagtgcacttgttgcagtagaaggcactgtgtaatgtggctggtatttttatgtttcctcatatcaatccttt 40606767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 10623554 - 10623510
Alignment:
18 acaaaaaatctcccaacaaggacaacaacaactaccaattactgt 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
10623554 acaaaaaatctcccaacaaggacaacaacaactaccaattactgt 10623510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University