View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3478_high_25 (Length: 236)
Name: NF3478_high_25
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3478_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 222
Target Start/End: Complemental strand, 31103062 - 31102843
Alignment:
| Q |
4 |
gtccctataaatgtatcaaaaaatatgcttttagtcttcatnnnnnnntggcacgttcacattcctataaaatgttttcagaagtttgacttaacaaatt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31103062 |
gtccctataaatgtatcaaaaaatatgcttttagtcttcataaaaaaatggcacgttcacattcctataaaatgttttcagaagtttgacttaacaaatt |
31102963 |
T |
|
| Q |
104 |
tgggattcataactgctaaccacaataatttgcaattactctgcatcaatttggcagcaggactggggaaatgaacctcattgat-gcgggtcatttgac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31102962 |
tgggattcataactgctaaccacaataatttgcaattactctgcatcaatttggcagcaggactggggaaatgaacctcattgatcgcgggtcatttgac |
31102863 |
T |
|
| Q |
203 |
aattgctcagatgggataat |
222 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
31102862 |
aattgctaagatgggataat |
31102843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University