View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3478_low_11 (Length: 395)
Name: NF3478_low_11
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3478_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 10647236 - 10646935
Alignment:
| Q |
1 |
cagcaccacgcttctctttactgttacgtttggtccacgaagatttaacccgaatagcaaatccaatatccctggcatggctattataatagttgtaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10647236 |
cagcaccacgcttctctttactgttacgtttggtccacgaagatttaacccgaatagcaaatccaatatccctggcatagctattataatagttgtaggc |
10647137 |
T |
 |
| Q |
101 |
atcatcataagtttcaaactccaatccctcaacaggttgggcgtagtcatttgttctttgagattcttcactatgactgtcaa-gctcgt------cgcc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| | || |
|
|
| T |
10647136 |
atcatcataagtttcaaactccaatccctcaacaggttgggcgtagtcatttgttctttgagattcttcactatgactgtcaactcccgtggtttcctcc |
10647037 |
T |
 |
| Q |
194 |
ctt--gtcctcaacctcaagtagttgcttactttgtggagatccctcatctatctggaaatagtaatgaaatnnnnnnnncaaattctaaacacaatcta |
291 |
Q |
| |
|
||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10647036 |
cttccattttcaagctcaagtagttgcttactttgtggagatccctcatctatctggaaatagtaatgaaataaaaaaaacaaattctaaacacaatcta |
10646937 |
T |
 |
| Q |
292 |
ag |
293 |
Q |
| |
|
|| |
|
|
| T |
10646936 |
ag |
10646935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University