View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3478_low_24 (Length: 238)
Name: NF3478_low_24
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3478_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 30782366 - 30782240
Alignment:
| Q |
1 |
caaaaatatattcaagaaatacacttccaaaagtcttttaaaaatatggaatggacagagttgttttcttgaacggagtcagttgcaacaattccgtgtt |
100 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30782366 |
caaaaatatattcgagaaatatacttccaaaaatcttttaaaaatatggaatggacagagttgttttcttgaacggagtcggttgcaacaattccgtgtt |
30782267 |
T |
 |
| Q |
101 |
acaaaggcccatgaaaggagacccgac |
127 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
30782266 |
acaaattcccatgaaaggagacccgac |
30782240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 30782124 - 30782061
Alignment:
| Q |
158 |
caataacaagatagaactatgaagaagcataacctagtaagaagatcaagcaacaacaaagaaa |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782124 |
caataacaagatagaacaatgaagaagcataacctagtaagaagatcaagcaacaacaaagaaa |
30782061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University