View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3478_low_27 (Length: 233)
Name: NF3478_low_27
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3478_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 148 - 218
Target Start/End: Original strand, 4571618 - 4571688
Alignment:
| Q |
148 |
tatctgcaaccacaattacggccacaacgttaaggttttgttatctatgtgacttcaattgtggttatatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4571618 |
tatctgcaaccacaattacggccacaacgtttaggttttgttatctatgtgacttcaattgtggttttatc |
4571688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 9 - 72
Target Start/End: Original strand, 4571479 - 4571542
Alignment:
| Q |
9 |
cgaattggaggccaacctactactggactagcagcatttctgttttagttggatcatcataatg |
72 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4571479 |
cgaattggaggccaacctactaccggactagcagcatttctgttttagttggatcatcataatg |
4571542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University