View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3478_low_8 (Length: 410)
Name: NF3478_low_8
Description: NF3478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3478_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 5 - 403
Target Start/End: Original strand, 10647294 - 10647692
Alignment:
| Q |
5 |
aagaaacacgaacaggctgtctagcaatgattagattgagagtagtggaatctaataggtggagggtggatgaagtcaagcttcagcataaccactcatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10647294 |
aagaaacacgaacaggctgtctagcaatgattagattgagagtagtggaatctaataggtggagggtggatgaagtcaagcttcagcataaccattcatt |
10647393 |
T |
 |
| Q |
105 |
tcatcctgaaagaccgcaaaactctaaatcacataagaggatggacagtggggccaaaagaaaggttgagccgaccctagatgttgcagtacggacaatc |
204 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
10647394 |
tgatcctgaaagaccgcaaaactctaaatcacataagaggatggacagtggggccaaaagaaaggttgagccgactctagatgttgctgtacggacaatc |
10647493 |
T |
 |
| Q |
205 |
aagttatatcgaatgccaactgtagatgtttccggttatgggagctcaaattctaatgaaggaggaactagcaccaacgttaaattttccaggagactga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10647494 |
aagttatatcgaatgccaactgtagatgtttccggttatgggagctcaaattctaatgaaggaggaactagcaccaacgttaaattttccaggagactga |
10647593 |
T |
 |
| Q |
305 |
agctnnnnnnnggtgatgcagaacttatttcaaattacttctgccaccgtcaactggggagtcctaattttttctatgtgatggatctgaatgatgatg |
403 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10647594 |
agctaaaaaaaggtgatgcagaacttgtttcaaattacttctgccaccgtcaactggggagtcctaattttttctatttgatggatctgaatgatgatg |
10647692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University