View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3480_high_11 (Length: 246)
Name: NF3480_high_11
Description: NF3480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3480_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 195087 - 195316
Alignment:
| Q |
9 |
gttcccacaatggggtgaccaagtgacgaatgccaagt--acttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacgaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195087 |
gttcccacaatggggtgaccaagtgacgaatgccaagtgtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacgaat |
195186 |
T |
|
| Q |
107 |
tgataaacagagatgaggtcaacaagtgtttgttggaggcaactgttggaaccaaggcaaaggagataaagcaaaatgtgctcagcttgaaggcggcagc |
206 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195187 |
tgataaacagagatgaggttaacaagtgtttgttggaggcaactgttggaaccaaggcaaaggagataaagcaaaatgtgctcagcttgaaggcggcagc |
195286 |
T |
|
| Q |
207 |
ggaagctgctattagagatggtggttcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
195287 |
ggaagctgctattagagatggtggttcttc |
195316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University