View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3480_low_2 (Length: 445)
Name: NF3480_low_2
Description: NF3480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3480_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 8e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 44637197 - 44637427
Alignment:
| Q |
1 |
catcccgcctgcgttttctttcgccgccgctttctgctcgtaccagcatcggatctcttcctcgtattggcgtagcttcctcttatcggcgccactgctc |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
44637197 |
catcctgcctgcgttttctttcgccgccgctttctgcccgtaccagcagcggatctcttcctcgtattggcgtagcttccccttatcggcgtcactgctc |
44637296 |
T |
 |
| Q |
101 |
cttgccgtcttcgttgtcattctccaagtcgcgatttacaaatcaaatacaatatgtttataaccaaagggactcttttaaacagataaatgaagcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
44637297 |
cttgccgtcttcgttgtcattctccaagtcgcgatttacaaatcgaatacagtatatttacaaccaaagggattcttctaaacagataaatgaagcaaca |
44637396 |
T |
 |
| Q |
201 |
cgcaattcctctgacactaaatattaagcaa |
231 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
44637397 |
cacaattcctctgacactaaatattaagcaa |
44637427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 279 - 426
Target Start/End: Original strand, 44637475 - 44637622
Alignment:
| Q |
279 |
cacatcctattcttgatgttttctggattttaaataaacataaccatggaaattatgagaagatggaatagtcactatcccgctgccatcgacgccggct |
378 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
44637475 |
cacatcctactcttgatgttttctggatttcaaataaacataaccatggaaattgtgagaagatggaacagtcactgtcccgctgccatcgacgccggct |
44637574 |
T |
 |
| Q |
379 |
ccgatagagggaaggtctgtgtgtcgtggttaaaataacataagggag |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44637575 |
ccgatagagggaaggtctgtgtgtcgtggttaaaataacagaagggag |
44637622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University