View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3481_low_14 (Length: 240)
Name: NF3481_low_14
Description: NF3481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3481_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 21 - 160
Target Start/End: Original strand, 25602601 - 25602740
Alignment:
| Q |
21 |
ctgatgtattggagaaaaggtttcctactttatgtaaactgaactcattggaagtaaatgagatacatgtaaaccgaagtcattggaagtaaatgagatg |
120 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
25602601 |
ctgatgtattagagaaaaggtgtcctactttatgtaaactgaaatcattggaagtaaatgagatacatgtaaaccgaagtcataggaactaaatgagata |
25602700 |
T |
|
| Q |
121 |
caagagatttaaataaaagtgtaattttcagcaagttact |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25602701 |
caagagatttaaataaaagtgtaattttcagcaaattact |
25602740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 164 - 240
Target Start/End: Original strand, 25602827 - 25602903
Alignment:
| Q |
164 |
ttgagaatagctctttcaaatatgaatggataacaaaaagattttcaaaatatcagaggttcttgaatttgttggct |
240 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25602827 |
ttgagaatagctctttcaaacatgaatggataacaaaaagattttcaaaatatcagaggttcttgaatttgttggct |
25602903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University