View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3481_low_9 (Length: 286)
Name: NF3481_low_9
Description: NF3481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3481_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 30432341 - 30432615
Alignment:
| Q |
1 |
ttgttagaaggagtgaattcaaattgtgtgtggtgccctggtaacctagaggtcgaggacaatttattttgtagacgtggttttgccggaaaggtgtggt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30432341 |
ttgttagaagaagtgaattcaaattgtgtgtggtgccttgggaacctagaggtcaaggacaatttattttgtagacgtgattttgccggaaaggtgtggt |
30432440 |
T |
|
| Q |
101 |
gcttgatctttaagtagattggtacgagagtgatcctacctgaaaatgagg-----tttctctctttgataatttcataacttcatcttagaataaaatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30432441 |
gcttgatctttaagtagattggtacgagagcgatcctacctgaaaatgaggtttaatttctctctttgataatttcataacttcatcttggaataaaatc |
30432540 |
T |
|
| Q |
196 |
cattgaaaagtgttaaatcttatttcgtacggtgcaatttgaaagatatgagaggctaggaataaggttattttt |
270 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30432541 |
cattgaaaagtgttaaatcttatttcgcacggtacaatttgaaagatatgagaggctaggaataaggttattttt |
30432615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University