View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_high_19 (Length: 445)
Name: NF3482_high_19
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 257 - 430
Target Start/End: Complemental strand, 1237637 - 1237464
Alignment:
| Q |
257 |
aaaaagatcgaccaactgtatcgttccaaggaccaaactgtacaattgatagctaataataatatgataagcattggggcatgtcatgatgttttgaaca |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1237637 |
aaaaagatcgaccaactgtatcgttccaaggaccaaactgtacaattgatagctaata------tgataagcattgggg-atgtcatgatgttttgaaca |
1237545 |
T |
|
| Q |
357 |
tgttgctgctaat---tgctcttgtatttgatcctag----gtacaaagttagatatattaagtactcctgctgattgatt |
430 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1237544 |
tgttgctgctaataattgctcttgtatttgatcctagctaggtacaaagttagatatattaagtactcctgctgattgatt |
1237464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University