View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_high_29 (Length: 362)
Name: NF3482_high_29
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 253 - 348
Target Start/End: Complemental strand, 28643548 - 28643453
Alignment:
| Q |
253 |
ccacaataaagatgattatgtccacctagcaaatggtgcatcaagtatgttgcaattagaacctataagaaagatggttatgggttttgttgttgt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28643548 |
ccacaataaagatgattatgtccacctagcaaatggtgcatcaagtatgttgcaattagaacctataagaaagatggttatgggttttgttgttgt |
28643453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 346
Target Start/End: Complemental strand, 20884814 - 20884644
Alignment:
| Q |
174 |
cttcccatatccattctctattt----tttcaactttttaggctgtgtgtgttaaaattaaaattttatgctacaattagaacccacaataaagatgatt |
269 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| | || | ||||||||| |||| || ||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
20884814 |
cttccaatatccattctctatttattttttcaactttatgggttttgtgtgttagaattggaa----atgctacgattagaaccca-aatgaagatgatt |
20884720 |
T |
|
| Q |
270 |
atgtccacctagcaaatggtgcatcaagtatgttgcaattagaacctataagaaagatggttatgggttttgttgtt |
346 |
Q |
| |
|
|||||| ||||||||| |||||| ||| ||||| ||||||||||| | || ||||||| ||||||||||||||||| |
|
|
| T |
20884719 |
atgtccgcctagcaaagggtgcaacaaccatgttacaattagaaccga-aataaagatgattatgggttttgttgtt |
20884644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University