View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3482_high_52 (Length: 276)

Name: NF3482_high_52
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3482_high_52
NF3482_high_52
[»] chr3 (2 HSPs)
chr3 (10-152)||(47706518-47706660)
chr3 (178-276)||(47705162-47705264)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 47706660 - 47706518
Alignment:
10 gcagagaaataaatttggatatctgacagattgggacagtactgcaagcaataacattaacagtcagggatataaggttgcctagccatgtgtccaggaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47706660 gcagagaaataaatttggatatctgacagattgggacagtactgcaagcaataacattaacagtcagggatataaggttgcctagccatgtgtccaggaa 47706561  T
110 ttataataatttcagaaatcatatttctttataaccatttcac 152  Q
    |||| ||||||||||||||||||||||||||||||||||||||    
47706560 ttattataatttcagaaatcatatttctttataaccatttcac 47706518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 178 - 276
Target Start/End: Complemental strand, 47705264 - 47705162
Alignment:
178 gggaatgtgtgatgattattccatgacataattaattagagcactcaatgtttttaattatc-------gattgata-ttgataggatgacataaaaata 269  Q
    ||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||       |||||||| ||| ||||||||||||||||||    
47705264 gggaatgtgtgatgattattccatgacataatta----gagcactcaatgtttttaattatcgattatcgattgatatttggtaggatgacataaaaata 47705169  T
270 ttacgca 276  Q
    |||||||    
47705168 ttacgca 47705162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University