View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_high_62 (Length: 247)
Name: NF3482_high_62
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_high_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 52441090 - 52440880
Alignment:
| Q |
21 |
gatttcagacatttcaagagggaccctattttgagactccaaaagcagacccaaaaagtgtagcttcaatcattttgggtggtggtgctggaactcgcct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52441090 |
gatttcagacatttcaagagggaccctattttgagactccaaaagcagacccaaaaagtgtagcttcaatcattttgggtggtggtgctggaactcgcct |
52440991 |
T |
 |
| Q |
121 |
ttttcctcttactagcaaaagagccaaacctgcggtaaaaatattacttttttgttctttctgtaaagtttttcaatgttgtttagtaccagtggttgca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52440990 |
ttttcctcttactagcaaaagagccaaacctgcggtaaaaatattacttttttgttctttctgtaaagtttttcaatgttgtttagtaccagtggttgca |
52440891 |
T |
 |
| Q |
221 |
attgcattatg |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
52440890 |
attgcattatg |
52440880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University