View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_high_65 (Length: 242)
Name: NF3482_high_65
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 120 - 238
Target Start/End: Original strand, 29930882 - 29931000
Alignment:
| Q |
120 |
agaagatggtatgatttcacacaggaatatcaacaaattcatttaaacatggaggacgaatgctgtccataatttcgcaaaatattgatgggacaaaagg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
29930882 |
agaagatggtatgatttcacacaggaatatcaacaaattcatttaaacatggatgacgaatgctgtcgataatttcgcaaaatattgaagtgacaaaagg |
29930981 |
T |
 |
| Q |
220 |
gtctattataactcatctc |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29930982 |
gtctattataactcatctc |
29931000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 29930725 - 29930833
Alignment:
| Q |
1 |
cacaatctctaaacatgtgcataaataataatagattcaggttggttatggcatctcggacaatttggatctgagtcatgtttcttctatacctctcctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29930725 |
cacaatctctaaacatgtgcataaata---atagattcaggttggttatggcatctcggacaatttggatctgattcatgtttcttctatacctctcctc |
29930821 |
T |
 |
| Q |
101 |
gttcgtgaggaa |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29930822 |
gttcgtgaggaa |
29930833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University