View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_high_80 (Length: 223)
Name: NF3482_high_80
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_high_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 43016169 - 43016367
Alignment:
| Q |
1 |
atgaccagaagcattattttggctctatattgctatagaatgaaattaacaaatgagttttcgtgaaggcttttattgaattcctttgtagattccactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016169 |
atgaccagaagcattattttggctctatattgctatagaatgaaattaacaaatgagttttcgtgaaggcttttattgaattcctttgtagattccactc |
43016268 |
T |
 |
| Q |
101 |
ttgatcataattttatacctatgaggtgtacaaatagtgtattgtatttatttatttatcagatgttactgaaaatagtttgtatatagcattaccgtaa |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016269 |
ttgatcataattctatacctatgaggtgtacaaatagtgtattgtatttatttat----cag---ttactgaaaatagtttgtatatagcattaccgtaa |
43016361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University