View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3482_high_81 (Length: 216)

Name: NF3482_high_81

Description: NF3482

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF3482_high_81

[»] chr8 (1 HSPs)

[»] chr4 (1 HSPs)

Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)

Name: chr8

Description:

Target: chr8; HSP #1

Raw Score: 180; E-Value: 2e-97

Query Start/End: Original strand, 20 - 203

Target Start/End: Original strand, 29582248 - 29582431

Alignment:

Q	20	tgatcgcgatggtaacggttacatcaccgcggctgagcttgccggatccatggcaaagatgggccatcctctaacataccatgagcttgctaacatgatg	119	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	29582248	tgatcgcgatggtaacggttacatcaccgcggctgagcttgccggatccatggcaaagatgggccatcctctaacataccatgagcttgctaacatgatg	29582347	T

Q	120	gctgaagctgatagcaatggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgatattctt	203	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|
T	29582348	gctgaagctgatagcaatggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattttctt	29582431	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)

Name: chr4

Description:

Target: chr4; HSP #1

Raw Score: 31; E-Value: 0.00000002

Query Start/End: Original strand, 136 - 182

Target Start/End: Original strand, 46040907 - 46040953

Alignment:

Q	136	atggtgatggtgttattagtttcaatgagtttgctaccattttggct	182	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|
T	46040907	atggtgatggtgttattagttttagtgagtttgctactattatggct	46040953	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]