View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_33 (Length: 346)
Name: NF3482_low_33
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 132 - 338
Target Start/End: Original strand, 9696284 - 9696486
Alignment:
| Q |
132 |
gttgcaccatataattggtgtagggtatctatttttcacatagctatatgacattaaaaaacagtagtggcaatttgatgtannnnnnnnnactcgagaa |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||| ||| |
|
|
| T |
9696284 |
gttgcaccatataattggtg----gtatctatttttcacatagctatatgacatcaaaaaatagtagtggcaatttgatgtacttttttttactcgggaa |
9696379 |
T |
 |
| Q |
232 |
atttgatgtactagaatagatataagctgtttagtttattctt--tatatttagggcatttatattatatnnnnnnnttaattgattttctcccttaaat |
329 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9696380 |
atttgatgtactagaatag--ataagctgtttagtttattctttatatatttagggcatttatattatataaaaaaactaattgtttttctcccttaaat |
9696477 |
T |
 |
| Q |
330 |
tttgtttac |
338 |
Q |
| |
|
||| ||||| |
|
|
| T |
9696478 |
tttttttac |
9696486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 9695848 - 9695974
Alignment:
| Q |
18 |
gtgtatttatccatctatgtagggtttggaataatccttacaatgtagcatt-----gtgagcagttgtagatctaaagagaaaaacttatctcattaaa |
112 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9695848 |
gtgtatttatccatctatgtcgggtttagaataatccttacaatgtagcattacattgtgagcagttgtagatctaaagagaaaaacttatcttattaaa |
9695947 |
T |
 |
| Q |
113 |
gttaataattatcatcattgttgcacc |
139 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
9695948 |
gttaataattatcatcattattgcacc |
9695974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University