View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_40 (Length: 324)
Name: NF3482_low_40
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 307
Target Start/End: Original strand, 49131983 - 49132274
Alignment:
| Q |
16 |
acagatttcattggtcgaaaaggggtaatgaaaatgttaatttccttcgaatatatgcactttacaattataggaccattcattattaacaagccttaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49131983 |
acagatttcattggtcgaaaaggggtaatgaaaatgtcaatttccttcgaatatatgcactttacaattataggaccattcattattaacaagccttaaa |
49132082 |
T |
 |
| Q |
116 |
attcacaggcaatgagattgtcaacaggattctgcataacaggatggttggctgtcttcttttcaaaggtgtgtatatcttctacacaatatttaccgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132083 |
attcacaggcaatgagattgtcaacaggattctgcataacaggatggctggctgtcttcttttcaaaggtgtgtatatcttctacacaatatttaccgaa |
49132182 |
T |
 |
| Q |
216 |
gnnnnnnngaattttacaaaatgcaaaagaattattacattactcacttgtgttattctttttaatgcaggatccttactcacttgatatag |
307 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132183 |
gaaaaaaagaattttacaaaatgcaaaagaattattacattactcacttgtgttattctttttaatgcaggatccttactcacttgatatag |
49132274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University