View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_53 (Length: 276)
Name: NF3482_low_53
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 10 - 152
Target Start/End: Complemental strand, 47706660 - 47706518
Alignment:
| Q |
10 |
gcagagaaataaatttggatatctgacagattgggacagtactgcaagcaataacattaacagtcagggatataaggttgcctagccatgtgtccaggaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706660 |
gcagagaaataaatttggatatctgacagattgggacagtactgcaagcaataacattaacagtcagggatataaggttgcctagccatgtgtccaggaa |
47706561 |
T |
 |
| Q |
110 |
ttataataatttcagaaatcatatttctttataaccatttcac |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47706560 |
ttattataatttcagaaatcatatttctttataaccatttcac |
47706518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 178 - 276
Target Start/End: Complemental strand, 47705264 - 47705162
Alignment:
| Q |
178 |
gggaatgtgtgatgattattccatgacataattaattagagcactcaatgtttttaattatc-------gattgata-ttgataggatgacataaaaata |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
47705264 |
gggaatgtgtgatgattattccatgacataatta----gagcactcaatgtttttaattatcgattatcgattgatatttggtaggatgacataaaaata |
47705169 |
T |
 |
| Q |
270 |
ttacgca |
276 |
Q |
| |
|
||||||| |
|
|
| T |
47705168 |
ttacgca |
47705162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University