View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_59 (Length: 251)
Name: NF3482_low_59
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 39 - 243
Target Start/End: Original strand, 9696627 - 9696833
Alignment:
| Q |
39 |
taatcacatgattcaagtaatattttgtttaattagaggtcttaggtttgaa--atcctgaaaatgcaacaacgtagttataaccatcttgagaaattat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9696627 |
taatcacatgattcaagtaatattttgtttaattagaggttttaggttcgaagcatcctaaaaatgcaacaacgtaattataaccatcttgagaaattaa |
9696726 |
T |
|
| Q |
137 |
tttttacaattgtgtgtagaaaacactagatatacgtcataaaataaatagtaagtttaatcatattttctattgaataattaattaatttatacggaaa |
236 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9696727 |
tttttacaattgtgtgtggaaaacactagatatacgtcataaaataaatagtaagtttaatcatattttctattgaataattaattaatttatacggaga |
9696826 |
T |
|
| Q |
237 |
ttcatct |
243 |
Q |
| |
|
|||||| |
|
|
| T |
9696827 |
atcatct |
9696833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University