View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_67 (Length: 239)
Name: NF3482_low_67
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 53346138 - 53345924
Alignment:
| Q |
1 |
atcacgagacacgaaagtatatacagaaagaacnnnnnnncttcaatctattaccagttggtcttgaaatagactagtaatgaagtatgaaaattcttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53346138 |
atcacgagacacgaaagtatatacagaaagaacaaaaaaacttcaatctattaccagttggtcttgaaatagactagtaatgaagtatgaaaattcttgt |
53346039 |
T |
 |
| Q |
101 |
ctctaaca----attataaaggttttagcactgtaaggactacacgtgatgtttaatctgaaagtaaaattaaattcattatcatgcattagctatattt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53346038 |
ctctaacaattaattataaaggttttagcactgtaaggactacacgtgatgtttaatctga----------aaattcattatcatgcattagctatattt |
53345949 |
T |
 |
| Q |
197 |
tcttgtgttttgctaccgatggatc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53345948 |
tcttgtgttttgctaccgatggatc |
53345924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University