View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_69 (Length: 238)
Name: NF3482_low_69
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 5106801 - 5106942
Alignment:
| Q |
1 |
taaccatctttgcaagaactgtgaccttcaagatgtcaaagtcatcgagggtctttcacgacatccgctagtgattggtccggcgccacttggttgggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5106801 |
taaccatctttgcaagaactgtgaccttcaagatgtcaaagtcatcgaggttc---cacaacatccgctagtgattggtccgccgccacttggttgggat |
5106897 |
T |
 |
| Q |
101 |
ccatgacatccgccagttcatgcgattggttgggatccacgacat |
145 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
5106898 |
ccacgacatctgccagttcatgcgattggttgggatccccgacat |
5106942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 126 - 210
Target Start/End: Original strand, 5106887 - 5106971
Alignment:
| Q |
126 |
ttggttgggatccacgacatccgccagttcatgcaattggttgggatccccgacatatgcgataggtcaaagtcattgagtgtct |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5106887 |
ttggttgggatccacgacatctgccagttcatgcgattggttgggatccccgacatatgcgataggtcaaagtcattgagtgtct |
5106971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 5102576 - 5102623
Alignment:
| Q |
1 |
taaccatctttgcaagaactgtgac---cttcaagatgtcaaagtcat |
45 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
5102576 |
taaccatctttgcaggaactgtgaccttcttcaagatgtcaaagtcat |
5102623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University