View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_73 (Length: 236)
Name: NF3482_low_73
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_73 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 7e-36; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 123 - 219
Target Start/End: Complemental strand, 32589664 - 32589568
Alignment:
| Q |
123 |
gttcttgcatacaacttcttgctaaaaattatatggatataggtatgggcaggtcctctcaataataacaaagtagcagtggtcttatggaatagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
32589664 |
gttcttgcatacaacttcttgctaaaaattctatggagataggtatgggcaggtcctctcactaataacaaagtagcagtgattttatggaatagaa |
32589568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 123 - 219
Target Start/End: Complemental strand, 32600112 - 32600016
Alignment:
| Q |
123 |
gttcttgcatacaacttcttgctaaaaattatatggatataggtatgggcaggtcctctcaataataacaaagtagcagtggtcttatggaatagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
32600112 |
gttcttgcatacaacttcttgctaaaaattctatggagataggtatgggcaggtcctctcactaataacaaagtagcagtgattttatggaatagaa |
32600016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32589895 - 32589801
Alignment:
| Q |
1 |
aaacttggagttcagggaaagaaagtcaaaagcaacaatgatttagaggtgacattattatctttccc------ttttatggtgtttaagtttga |
89 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32589895 |
aaacttggagttcagggaaagaaagtaaaaagcaacaatgatttagaggtgacattattttctttccctttatattttatggtgtttaagtttga |
32589801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32600343 - 32600249
Alignment:
| Q |
1 |
aaacttggagttcagggaaagaaagtcaaaagcaacaatgatttagaggtgacattattatctttccc------ttttatggtgtttaagtttga |
89 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32600343 |
aaacttggagttcagggaaagaaagtaaaaagcaacaatgatttagaggtgacattattttctttccctttatattttatggtgtttaagtttga |
32600249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 34577658 - 34577588
Alignment:
| Q |
1 |
aaacttggagttcagggaaagaaagtcaaaagcaacaatgatttagaggtgacattattatctttcccttt |
71 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||| ||||| |
|
|
| T |
34577658 |
aaacttggagttcagggaaagaaagtaaaaagcaacaatgatttagaggtgatattattttcttttccttt |
34577588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 34577373 - 34577317
Alignment:
| Q |
163 |
aggtatgggcaggtcctctcaataataacaaagtagcagtggtcttatggaatagaa |
219 |
Q |
| |
|
|||||||||||||||| || | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34577373 |
aggtatgggcaggtccccttagtaaaaacaaagtagcagtggtcttatggaatagaa |
34577317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University