View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_78 (Length: 230)
Name: NF3482_low_78
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 34192553 - 34192359
Alignment:
| Q |
19 |
tatggggagatgaagctgaaggagaaacaagaagaatagtaggaacctagtaagtatgcttaaattgatgactttaatttgtttctttataaaccataaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34192553 |
tatggggagatgaagctgaaggagaaacaagaagaatagtaggaacttagtaagtatgcttaaattgatgactttaatttgtttctttataaactataaa |
34192454 |
T |
|
| Q |
119 |
tattcactatcctgttttctaagcccagtatcctt-ttttctttactgtgtttcagtggttacatgtctccagagttcgcgacacgtggattttt |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34192453 |
tattcactatcatgttttctaagcccagtatcctttttttctttactgtgtttcagtggttacatgtctccagaattcgcgacacgtggattttt |
34192359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 34219098 - 34219202
Alignment:
| Q |
19 |
tatggggagatgaagctgaaggagaaacaagaagaatagtaggaacctagtaagtatgcttaaattgatgactttaatttgtttctttataaaccataaa |
118 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||| |||||||||| ||||||| || ||| | |||||||||||||||| ||| ||||| ||||| |
|
|
| T |
34219098 |
tatggggagatgaagcaaaaggggtaacaagaagagtagtaggaacttagtaagcatacttca----atgactttaatttgttgcttcataaattataaa |
34219193 |
T |
|
| Q |
119 |
tattcacta |
127 |
Q |
| |
|
||||||||| |
|
|
| T |
34219194 |
tattcacta |
34219202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 82
Target Start/End: Original strand, 34207948 - 34208011
Alignment:
| Q |
19 |
tatggggagatgaagctgaaggagaaacaagaagaatagtaggaacctagtaagtatgcttaaa |
82 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| |||||||||| |||||| ||||||||| |
|
|
| T |
34207948 |
tatggggagatgaagctgaagtcgaaacaattagagtagtaggaactcagtaagcatgcttaaa |
34208011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University