View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3482_low_79 (Length: 228)
Name: NF3482_low_79
Description: NF3482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3482_low_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 52441320 - 52441142
Alignment:
| Q |
1 |
ttcttaggtgaaactactaagggaagtttaagcacgacaagattccttaccattcaatcacccaaatcattcaatcttaaaaatggagctgaacacaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52441320 |
ttcttaggtgaaactactaagggaagtttaagcacaacaagattccttaccattcaatcacccaaatcattcaatcctaaaaatggagctgaacacaacg |
52441221 |
T |
 |
| Q |
101 |
ttctcacttcagggatcaatgatcatcaagactccacggtactcaattctaataccatcaaaagaggggaaaaaaatcac |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52441220 |
ttctcacttcagggatcaatgatcatcaagactccacggtactcaattctaataccatcaaaaga-gggaaaaaaatcac |
52441142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University