View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3483_high_8 (Length: 250)
Name: NF3483_high_8
Description: NF3483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3483_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 25 - 230
Target Start/End: Original strand, 33717991 - 33718196
Alignment:
| Q |
25 |
aatgtatgatgatgattaaatcctttttcaaatttaaggatgtttccaaatcttatcatttattactctagtttgtatcatcaacatgcttatattgatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717991 |
aatgtatgatgatgattaaatcctttttcaaatttaaggatgtttccaaatcttatcatttattactctagtttgtatcatcaacatgcttatattgatg |
33718090 |
T |
 |
| Q |
125 |
aatgatagtttttatttttaacaaatgactatgcagtttgatgatgttgtgtacaaaatcaaagccaaaaaaggaggactatttaagaagaacatagaag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718091 |
aatgatagtttttatttttaacaaatgactatgcagtttgatgatgttgtgtacaaaatcaaagccaaaaaaggaggactatttaagaagaacatagaag |
33718190 |
T |
 |
| Q |
225 |
tagaag |
230 |
Q |
| |
|
|||||| |
|
|
| T |
33718191 |
tagaag |
33718196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University