View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3483_low_8 (Length: 278)
Name: NF3483_low_8
Description: NF3483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3483_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 43644818 - 43644569
Alignment:
| Q |
12 |
agagacgtggaaatcaagaataaagcatttannnnnnnattgtatgttccatgaaaactgaagcatttacttgttacatgcaggtcctggtgcaagtatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43644818 |
agagacgtggaaatcaagaataaagcatttatttttttattgtatgttccatgaaaactgaagcatttacttgttaaatgcaggtcctggtgcaagtatt |
43644719 |
T |
 |
| Q |
112 |
ggagggatgtgtgctacacgttgctctggttcgttagctgtgaggtggctactttccttttatatgnnnnnnncatctattgctggcaatcactgccacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43644718 |
ggagggatgtgtgctacacgttgctctggttcgttagctgtgaggtggctactttccttttatatgtttttttcatctattgctggcaatcactgccacc |
43644619 |
T |
 |
| Q |
212 |
tgctggttaaaatgtttaaactctgcgggtgtcaaattgtccgtgcttac |
261 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43644618 |
tgctggttaaaatgtttaaactctgtgggtgtcaaattgtccgtgcttac |
43644569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University