View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3484_high_14 (Length: 236)
Name: NF3484_high_14
Description: NF3484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3484_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4176718 - 4176490
Alignment:
| Q |
1 |
tgacttttatatgttcctatagcagccatggcac--------caataaccaaggcgttcttgaaatatgtccggtcccatttggaaaatatgtacattgt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4176718 |
tgacttttatatgttcctatagcagccatggcactgtttcaccaataaccaaggcgttcttgaaatatgtccggtcccatttggaaaatatgtacattgt |
4176619 |
T |
|
| Q |
93 |
ccaaagctgaacacacaacacacgatcactctacaactcaacgttatactcctatcaaacacaaacagaattgaacatcatggctacaacaacttcgtct |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4176618 |
ccaaagctgaacacgcaacacacgatcactctacaactcaacgttatactcctatcaaacacaaacagaattgaacatcatggctacaacaacttcgtct |
4176519 |
T |
|
| Q |
193 |
tttatgtttcttaaacgaattcttacatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4176518 |
tttatgtttcttaaacgaattcttacatc |
4176490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 146 - 207
Target Start/End: Complemental strand, 4172413 - 4172349
Alignment:
| Q |
146 |
atcaaacacaaacagaattgaacat---catggctacaacaacttcgtcttttatgtttcttaaa |
207 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
4172413 |
atcaaacacaatctgaattgaacatgtccatggctacaacaacctcgtcttttatgattcttaaa |
4172349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University