View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3484_high_7 (Length: 319)
Name: NF3484_high_7
Description: NF3484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3484_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 10667142 - 10667454
Alignment:
| Q |
1 |
taagattacaagagaaacacatttttaagacaacaatgatgagatggttcttcatctttatacatttcaaataattgtttgtaggtttaannnnnnnatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10667142 |
taagattacaagagaaacacatttttaagacaacaatgatgagatggttcttcatctttatacatttcaaataattgtttgtaggtttaatttttttatt |
10667241 |
T |
|
| Q |
101 |
aaacaagatatgtaagtgcatctttgaatattaatttcggaaggtgtgtgggattcaaataagaggtcaattctcttaacaaatataaagaatataaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
10667242 |
aaacaagatatgtaagtgcatctttgaatattaatttcggaaggtgtgtgggattcaaataagaggtaaaatctcttaacaaatataaagaatataaatt |
10667341 |
T |
|
| Q |
201 |
ttcgtataaatggtctttttgattgatttatttaagtttttgattgatgtgcatatgggtggggataggctaggatgaactagactttgcaaagcgtcta |
300 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| || ||||||||||||| | |||| |
|
|
| T |
10667342 |
ttcctataaatggtctttttgattgatttatttaagtttttgattgatgtgcatagcggtagggataggctagaccgagctagactttgcaagacatcta |
10667441 |
T |
|
| Q |
301 |
acatattcttcga |
313 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
10667442 |
acatatttttcga |
10667454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University