View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3484_low_12 (Length: 264)
Name: NF3484_low_12
Description: NF3484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3484_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 264
Target Start/End: Complemental strand, 9788883 - 9788626
Alignment:
| Q |
7 |
gatatatcatcaacaacccttaatgttgtggaagtagaacacactatagtggatgaatcaacaaaacccatggtgctagcaactccccaacagggaaacg |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9788883 |
gatatgtcatcaacaacccttaatgttgtggaagtagaacacactatagtggacgaatcaacaaaacccatggtgctagcaactccccaacagggaaacg |
9788784 |
T |
|
| Q |
107 |
aattatctaaattgtaaggcaataatgtgcgcatgttgaccattattctctacattatcaatggtaaaaatctactattaatcttggctattgaaaatgt |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9788783 |
aattatctcaattgtaaggcaataatgtgcgcatgttgaccattattctctacattatcaatggtaaaaatctactattaatcttggctattgaaaatgt |
9788684 |
T |
|
| Q |
207 |
tgttatctattgtacagatctccatgttattttctcaggggtttttcaatagcgagaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9788683 |
tgttatctattgtacagatctccatgttattttctcaggggtttttcaatagagagaa |
9788626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University