View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3484_low_9 (Length: 297)
Name: NF3484_low_9
Description: NF3484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3484_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 34 - 254
Target Start/End: Complemental strand, 14396626 - 14396411
Alignment:
| Q |
34 |
atagtgcagactatatttcctgataattggccggatagaaagattcgaagatttagtacacttactttatattataccatacagtattggaatgtgtgtg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
14396626 |
atagtgcagactatatttcctgataattggccggatagaaagattcgaagatttaatacacttactttatactatac-----agtattggaatgtgtgtg |
14396532 |
T |
 |
| Q |
134 |
ccgagccaagaagaaggagcccgaaacactacatgaaatactaacttctgatatcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactc |
233 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14396531 |
ccgagccgagaagaaggagcccgaaacaatacatgaaatactaacttctgatatcttccatagatgtttgcttgcatgtgctgctgctgatcaagtactc |
14396432 |
T |
 |
| Q |
234 |
caaataactcgcactagcagc |
254 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14396431 |
caaataactcgcactagcagc |
14396411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University