View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_high_24 (Length: 337)
Name: NF3485_high_24
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 33 - 296
Target Start/End: Complemental strand, 39054958 - 39054695
Alignment:
| Q |
33 |
tcttggcgtgagtatcttcttcgctaggacatctatactctagtacaactttatttcaaacatcaccaaaacactcacattctgcaactaaatgttgaga |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39054958 |
tcttggcgtgagtatcttcttcgctaggacatctatattctagtacaactttatttcaaacatcaccaaaacactcacattctgcaactaaatgttgaga |
39054859 |
T |
 |
| Q |
133 |
acattgaagtaatccataatcactagcatggtgtatatttgaagaggttattcggtgactaggaagattatccttggtagggaccctattttgcaatgag |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39054858 |
acattgaagtaatccataatcactagcatggtgtatatttgaagaggttattcggtgactaggaagattatccttggtagggaccctattttgcaaagag |
39054759 |
T |
 |
| Q |
233 |
agaaacctttataataataaatttgttcaacgtaaaatcatacataggagacctagctctatga |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39054758 |
agaaacctttataataataaatttgttcaacgtaaaatcatacataggagacctatctctatga |
39054695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University