View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_high_31 (Length: 257)
Name: NF3485_high_31
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 47077633 - 47077401
Alignment:
| Q |
17 |
cagcagcagcagcagctcagataggagaagggaaatgaaaaggctgcagtgaaggatatattaagctgaataggagaaggactatagaggagagtattac |
116 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077633 |
cagcaggagcagcagctcagataggggaagggaaatgaaaaggctgcagtgaaggatatattaagctgaataggagaaggactatagaggagagtattac |
47077534 |
T |
 |
| Q |
117 |
atcaacaacaacaagtacattattatcacattttttggaaaatgcgatcataagaatttaagtgtatgtaacttagtaagagtccaaacactactcagcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47077533 |
atcaacaacaacaagtacattattatcacattttttggaaaatgcgatcataagaatttaagtgtatgtaaattagtaagagtccaaacactactcagcc |
47077434 |
T |
 |
| Q |
217 |
acgtgaacggatattgcgggataagcctatgat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47077433 |
acgtgaacggatattgcgggataagcctatgat |
47077401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University