View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_high_46 (Length: 239)
Name: NF3485_high_46
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_high_46 |
 |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold1048 (1 HSPs) |
 |  |  |
|
| [»] scaffold0175 (1 HSPs) |
 |  |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 747856 - 747641
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatcgatgttaatgagaagtactaaagtgaatgagagaatcaataaacgatag |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
747856 |
gatatttattattacttcgatagttattgatatacttgccaattttctatcaatgttaatgagaagtactaaagtgaatgagataatcaataaacgatag |
747757 |
T |
 |
| Q |
108 |
ttatgctcgcatcgacaagtattctaagctttatcaaattttaatatgcataagtatacattaaaaatttaagacacacaaacaaacacacatattttta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
747756 |
ttatgctcgcatcgacaagtattctaagctttatcaaattttaatatgcataagtatacattaaaaatttaagacacacaaacaaacacacatattttta |
747657 |
T |
 |
| Q |
208 |
tctatatgtgtgtata |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
747656 |
tctatatgtgtgtata |
747641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 2349763 - 2349812
Alignment:
| Q |
9 |
atatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
2349763 |
atatttattactacttcgatagttattggtacacttgtcaattatctatc |
2349812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 20100946 - 20100996
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
20100946 |
gatatttattactacttcgatagttattggtacacttgccaaatttctatc |
20100996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 26460767 - 26460810
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
26460767 |
gatatttattactacttcgatagttattggtacacttgccaatt |
26460810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 709834 - 709784
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
709834 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
709784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 2252173 - 2252223
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
2252173 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
2252223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 23598579 - 23598529
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
23598579 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
23598529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 26182603 - 26182653
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| ||||| |||||| |
|
|
| T |
26182603 |
gatatttattactactttgatagttattggtacacttgccaattatctatc |
26182653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 3067788 - 3067746
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
3067788 |
ttactacttcgatagtatttggtatacttgtcaaatttctatc |
3067746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 3734615 - 3734665
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
3734615 |
gatatttattactacttcgatagttattggtacacttgccaattatctatc |
3734665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 49639633 - 49639583
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
49639633 |
gatatttattactacttcgatagttattggtacacttgccaattatctatc |
49639583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 3719312 - 3719262
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
3719312 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
3719262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 19929191 - 19929241
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
19929191 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
19929241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 49636340 - 49636290
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| ||||| |||||| |
|
|
| T |
49636340 |
gatatttattactacttcgatagttattgatacacttgccaattatctatc |
49636290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 39
Target Start/End: Original strand, 14702208 - 14702239
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggta |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14702208 |
gatatttattactacttcgatagttattggta |
14702239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 45
Target Start/End: Original strand, 11561115 - 11561156
Alignment:
| Q |
4 |
aaatgatatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
11561115 |
aaatgatatttattactacttcgatagttttttgtacacttg |
11561156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 5886798 - 5886748
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
5886798 |
gatatttattactacttcgatagttattggtacacttgccaattatctatc |
5886748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 5896782 - 5896732
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
5896782 |
gatatttattactacttcgatagttattggtacacttgccaattatctatc |
5896732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 23374544 - 23374494
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
23374544 |
gatatttattactatttcgatagttattggtacacttgccaattatctatc |
23374494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 29233404 - 29233354
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
29233404 |
gatattttttactacttcgatagttattggtacacttgccaattatctatc |
29233354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 6173163 - 6173127
Alignment:
| Q |
9 |
atatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6173163 |
atatttattactacttcgatagttattggtacacttg |
6173127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 16314404 - 16314354
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||| | |||||| |
|
|
| T |
16314404 |
gatatttattactacttccatagttattggtacacttgccaaatatctatc |
16314354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 16414570 - 16414520
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||| | |||||| |
|
|
| T |
16414570 |
gatatttattactacttccatagttattggtacacttgccaaatatctatc |
16414520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 18495398 - 18495348
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||| | |||||| |
|
|
| T |
18495398 |
gatatttattactacttccatagttattggtacacttgccaaatatctatc |
18495348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 28327763 - 28327805
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
28327763 |
ttactacttcgatagttattggtacacttgccaattatctatc |
28327805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 28331088 - 28331130
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
28331088 |
ttactacttcgatagttattggtacacttgccaattatctatc |
28331130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 18939196 - 18939246
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
18939196 |
gatatttattactacttcgatagttattggtacacttgccaattatctatc |
18939246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 22592815 - 22592851
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatactt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22592815 |
gatatttattactacttcgatagttattggtacactt |
22592851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 40677571 - 40677529
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
40677571 |
ttactacttcgatagttattggtacacttgccaattatctatc |
40677529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 37642163 - 37642213
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
37642163 |
gatatttattactacttcgatagttattggtacacttgtcaaatatctatc |
37642213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 16838750 - 16838707
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
16838750 |
gatatttattactacttcgatagttattggtacacttgccaatt |
16838707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 16848680 - 16848637
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
16848680 |
gatatttattactacttcgatagttattggtacacttgccaatt |
16848637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 17902604 - 17902554
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
17902604 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
17902554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 20981661 - 20981711
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
20981661 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
20981711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 24200060 - 24200010
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| ||| |||| |
|
|
| T |
24200060 |
gatatttattactacttcgatagttattggtacacttgccaaatttttatc |
24200010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 63
Target Start/End: Original strand, 28918679 - 28918733
Alignment:
| Q |
9 |
atatttattactacttcgatagttattggtatacttgtcaattttctatcgatgt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |||||| |||| |
|
|
| T |
28918679 |
atatttattactacttcgatagttattggtacacttgctaattatctatcaatgt |
28918733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 23441083 - 23441041
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
23441083 |
ttactacttcgatagttattggtacacttgccaattatctatc |
23441041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 33898644 - 33898686
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
33898644 |
ttactacttcgatagttattggtagacttgccaattatctatc |
33898686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 49716688 - 49716734
Alignment:
| Q |
12 |
tttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
49716688 |
tttattattacttcgatagtttttggtacacttgtcaattatctatc |
49716734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 56
Target Start/End: Original strand, 49720170 - 49720214
Alignment:
| Q |
12 |
tttattactacttcgatagttattggtatacttgtcaattttcta |
56 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||| |||| |
|
|
| T |
49720170 |
tttattattacttcgatagtttttggtacacttgtcaattatcta |
49720214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 17232158 - 17232207
Alignment:
| Q |
9 |
atatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
17232158 |
atatttattactacttcgatagttattggtacacttgtcaaatatctatc |
17232207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 22920831 - 22920881
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
22920831 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
22920881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 11411080 - 11411126
Alignment:
| Q |
12 |
tttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
11411080 |
tttattattacttcgatagtttttggtacacttgtcaattatctatc |
11411126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 32109987 - 32110029
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
32109987 |
ttactacttcgatagtttttggtacacttgtcaattgtctatc |
32110029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 2331585 - 2331634
Alignment:
| Q |
9 |
atatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| ||| | |||||| |
|
|
| T |
2331585 |
atatttattactacttcgatagtttttggtacacttgccaaatatctatc |
2331634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 27664 - 27707
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaatt |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27664 |
gatatttattactacttcgatagttattggtacacttgccaatt |
27707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1048 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold1048
Description:
Target: scaffold1048; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 1703 - 1753
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
1703 |
gatatttcttactacttcgatagttattggtacacttgccaattctctatc |
1753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 24903301 - 24903251
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
24903301 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
24903251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 24435334 - 24435383
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
24435334 |
gatatttattactacttcgatag-tattggtacacttgccaattatctatc |
24435383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 24445380 - 24445429
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
24445380 |
gatatttattactacttcgatag-tattggtacacttgccaattatctatc |
24445429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 17012848 - 17012811
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
17012848 |
gatatttgttactacttcgatagttattggtacacttg |
17012811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 17544353 - 17544390
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
17544353 |
gatatttgttactacttcgatagttattggtacacttg |
17544390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 26727248 - 26727298
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||| | |||||| |
|
|
| T |
26727248 |
gatatttattactacttcgatagttattggtacacttgccaaatatctatc |
26727298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 25185691 - 25185740
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||| | |||||| |
|
|
| T |
25185691 |
gatatttattactacttcgatagtt-ttggtacacttgtcaaatatctatc |
25185740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0175 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 28475 - 28438
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28475 |
gatatttattactacttcgatagttattggtacacttg |
28438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 26694 - 26657
Alignment:
| Q |
8 |
gatatttattactacttcgatagttattggtatacttg |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26694 |
gatatttattactacttcgatagttattggtacacttg |
26657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 92751 - 92793
Alignment:
| Q |
16 |
ttactacttcgatagttattggtatacttgtcaattttctatc |
58 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
92751 |
ttactacttcgatagttattggtacacttgccaattatctatc |
92793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University