View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_13 (Length: 432)
Name: NF3485_low_13
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 416; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 1 - 432
Target Start/End: Complemental strand, 54076252 - 54075821
Alignment:
| Q |
1 |
gtgtcaacaatttcaacctttgatctctaacctcacaaaacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076252 |
gtgtcaacaatttcaacctttgatctctaacctcacaaaacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttg |
54076153 |
T |
 |
| Q |
101 |
cgagtttgggttcatagcttgtctccaatccacaacataagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttataatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54076152 |
cgagtttgggttcatagcttgtctccaatccacaacataagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttatagtga |
54076053 |
T |
 |
| Q |
201 |
ttcaccaaaccctcttcgggaccaagttgtttcgatctaaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076052 |
ttcaccaaaccctcttcgggaccaagttgtttcgatctaaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactg |
54075953 |
T |
 |
| Q |
301 |
cttctaccaacacaattgatttgtgtctttgttccactttcctccgacacgtgtacccttgtgttaccccttctttcgggtgttgtctttgacctgatgg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54075952 |
cttctaccaacacaattgatttgtgtctttgttccactttcctccgacacgtgtacccctgtgttaccccttctttcgggtgttgtcgttgacctgatgg |
54075853 |
T |
 |
| Q |
401 |
gccaaattctaaacacatcattgacacctgtc |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54075852 |
cccaaattctaaacacatcattgacacctgtc |
54075821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University