View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_22 (Length: 342)
Name: NF3485_low_22
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_22 |
 | |
|
| [»] scaffold0152 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0152 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 338
Target Start/End: Complemental strand, 11917 - 11602
Alignment:
| Q |
20 |
atgatcattgtacgtagatgtatattgctgcaatcccacttagttgtttgtcctttcatatccataatttgatcacattaaccaattgaaaacttaattg |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11917 |
atgatcattgtacctagatgtatattgctgcaatcccacttagttgtttgtcctttcatatccataatt----cacattaaccaattgaaaacttaattg |
11822 |
T |
|
| Q |
120 |
acttgtactaaaaaatttaacaatttcattaccagcattnnnnnnnnnnt-agagaggtactgtcgannnnnnnnnacgcaagatcaaatgattgagtgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| | |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11821 |
acttgtactaaaaaatttaacaatttcattgccagcattaaaaaaaaatttagagaggtactgtcgatttttttttacgcaagatcaaatgattgagtgt |
11722 |
T |
|
| Q |
219 |
gttagaaaattctcacgttcattctgagttaaattcgaccagtttactctatatgctactgcttgaataaatattaatgcaaattgagacaatgatgaaa |
318 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11721 |
gttagaaaattctcacgttcattctaagttaaattcgaccagtttactctatatgctactgcttgaataaatattaatacaaattgagacaatgatgaaa |
11622 |
T |
|
| Q |
319 |
cataaaggcctttgcttctc |
338 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
11621 |
cataaaggccattgcttctc |
11602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University