View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_36 (Length: 254)
Name: NF3485_low_36
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 20 - 165
Target Start/End: Complemental strand, 12529261 - 12529119
Alignment:
| Q |
20 |
gtataagaatttaggaacaaaatatgttttaaaagtaatagatgaaatgataattatgctttaatttaaacttaaactagtttgaaagtattttattcaa |
119 |
Q |
| |
|
||||||||||||||| | | | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
12529261 |
gtataagaatttaggtatagaccatgttttaaatgtaatagatgaaatgataattatgctttaatttaaacttaaactagtttgaaattattttaaacaa |
12529162 |
T |
 |
| Q |
120 |
ataaatattatgtaagatctttatggtaattacttgtcaaattgct |
165 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
12529161 |
ataaatattatgtaagatctttattg---ttacttgtcaaattgct |
12529119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 59 - 165
Target Start/End: Original strand, 44668454 - 44668557
Alignment:
| Q |
59 |
agatgaaatgataattatgctttaatttaaacttaaactagtttgaaagtattttattcaaataaatattatgtaagatctttatggtaattacttgtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
44668454 |
agatgaaatgataattatgctttaatttaaacttaaactagtttgaaattattttaaccaaataaatattatgtaagatctttattg---ttacttgtca |
44668550 |
T |
 |
| Q |
159 |
aattgct |
165 |
Q |
| |
|
||||||| |
|
|
| T |
44668551 |
aattgct |
44668557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 44668384 - 44668438
Alignment:
| Q |
20 |
gtataagaatttaggaacaaaatatgttttaaaagtaatagatgaaatgataatt |
74 |
Q |
| |
|
||||||||||||||| | | | |||||||||| ||||||||||||||||||||| |
|
|
| T |
44668384 |
gtataagaatttaggtatagaccatgttttaaatgtaatagatgaaatgataatt |
44668438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University