View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3485_low_38 (Length: 251)

Name: NF3485_low_38
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3485_low_38
NF3485_low_38
[»] chr7 (2 HSPs)
chr7 (87-233)||(27921801-27921946)
chr7 (14-67)||(27922100-27922153)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 87 - 233
Target Start/End: Complemental strand, 27921946 - 27921801
Alignment:
87 agttatttctgttaatatttttccgatgttaaactctaaaactgaacttttaatttataaagtgttcgacaaagacnnnnnnnatctaagggatttgaaa 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||       |||||||||||||||||    
27921946 agttatttctgttaatatttttccgatgttaaactctaaaactgaacttttaatttataaagtgtttgacaaagac-ttttttatctaagggatttgaaa 27921848  T
187 taatttcatcagtagatctagttgctagacatatagctagatttgca 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
27921847 taatttcatcagtagatctagttgctagacatatagctagatttgca 27921801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 14 - 67
Target Start/End: Complemental strand, 27922153 - 27922100
Alignment:
14 gagcacagagtagtcgataagtatcaaattggtggaagcattcaagacttggat 67  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
27922153 gagcacaaagtagtcgataagtatcaaattggtggaagcattcaagacttggat 27922100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University